GSK126 alleviates the obesity phenotype by promoting the differentiation of thermogenic beige adipocytes in diet-induced obese mice
Xiaohui Wu a, b, Yuying Wang a, Yingmei Wang a, Xinli Wang c, Jianqiang Li d, Kaixuan Chang d, Cheng Sun d, Zhen Jia d, Song Gao e, Jiachang Wei e, Jiuhang Xu e,
Yuqiao Xu a, *, Qing Li a, **
a State Key Laboratory of Cancer Biology, Department of Pathology, The First Affiliated Hospital, Air Force Medical University, Xi’an, 710032, China
b China-Nepal Friendship Medical Research Center of Prof. Rajiv Kumar Jha, Xi’an Medical University, Xi’an, 710021, China
c Department of Orthopedics, The First Affiliated Hospital, Air Force Medical University, Xi’an, 710032, China
d Cadet Brigade, Air Force Medical University, Xi’an, 710032, China
e Aeronautics and Astronautics Clinical Medicine School, Air Force Medical University, Xi’an, 710032, China
a r t i c l e i n f o
Article history:
Received 6 April 2018
Accepted 10 April 2018 Available online xxx
Keywords: GSK126 H3K27me3
Ezh2 Obesity
Beige adipocyte
a b s t r a c t
A close relationship between epigenetic regulation and obesity has been demonstrated in several recent studies. Histone methyltransferase enhancer of Zeste homolog 2 (Ezh2), which mainly catalyzes trime- thylation of histone H3K27 to form H3K27me3 was found to be required for the differentiation of white and brown adipocytes in vitro. Here, we investigated the effects of the Ezh2-specific inhibitor GSK126 in a mouse model of obesity induced by a high-fat diet (HFD). We found that GSK126 treatment reduced body fat, improved glucose tolerance, increased lipolysis and improved cold tolerance in mice by pro- moting the differentiation of thermogenic beige adipocytes. Moreover, we discovered that GSK126 inhibited the differentiation of white adipocytes, and the decrease of Ezh2 enzymatic activity and H3K27me3 also changed the morphology of brown adipocytes but did not alter the expression of thermogenic genes in these cells. Our results indicated that GSK126 was a novel chemical inducer of beige adipocytes and may be a potential therapeutic agent for the management of obesity. Furthermore, they also prompted that Ezh2 and H3K27me3 play different roles in the differentiation of the white, brown, and beige adipocytes in vivo.
© 2018 Elsevier Inc. All rights reserved.
⦁ Introduction
The incidence of obesity, which is related to excessive energy intake without adequate energy expenditure, has been increasing rapidly both in developed and developing countries [1]. Because obesity is associated with insulin resistance, cardiovascular disease, and cancer [2e4], it is necessary to improve our understanding of the pathogenesis and treatment strategies, besides diet and
* Corresponding author. State Key Laboratory of Cancer Biology and Department of Pathology, The First Affiliated Hospital, Air Force Medical University, No.169 ChangLe West Road, Xi’an, Shaanxi, 710032, China.
** Corresponding author. State Key Laboratory of Cancer Biology and Department of Pathology, The First Affiliated Hospital, Air Force Medical University, No.169 ChangLe West Road, Xi’an, Shaanxi, 710032, China.
E-mail addresses: [email protected] (Y. Xu), [email protected] (Q. Li).
exercise, for this condition.
In mammals, there are three types of adipocytes: white adipo- cytes, classical brown adipocytes [5], and beige adipocytes [6]. White adipocytes have a single large lipid droplet with triglycerides (TGs) inside and store excess energy. In contrast, brown adipocytes contain multiple small lipid droplets and mitochondria expressing uncoupling protein 1 (Ucp1), which diminishes the proton gradient and uncouples oxidative phosphorylation during ATP synthesis [7], leading to energy dissipation by consumption TGs and/or glucose [8,9]. Beige adipocytes located within white adipose tissue (WAT) have similar morphology and function with classical brown adi- pocytes and can be induced by cold exposure and some chemical reagents; this phenomenon is called white fat browning [9]. Clas- sical brown adipocytes and beige adipocytes can both relieve obesity and glucose intolerance in rodent models and humans by producing heat. Notably, so-called brown adipocytes found in adult
https://doi.org/10.1016/j.bbrc.2018.04.073
0006-291X/© 2018 Elsevier Inc. All rights reserved.
humans are mainly composed of beige adipocytes [10]; thus, beige adipocytes have become an attractive therapeutic target for coun- teracting obesity and type 2 diabetes [9], and their differentiation and inducing reagents have become a major focus of researchers in this field.
Recently, researchers have found that some epigenetic factors contribute to the differentiation of adipocytes; for example, enhancer of Zeste homolog 2 (Ezh2), the enzymatic subunit of polycomb repressive complex 2, mainly catalyzes trimethylation of histone H3K27 to form H3K27me3 [11,12], was found to be required for the differentiation of both white and brown adipocytes in vitro [13,14]. In a study by Ferrari and colleagues, a chemical inhibitor of histone deacetylases, MS-275, was used to attenuate diet-induced obesity by white fat browning in mice [15]. However, it is unclear whether biochemical inhibitors of Ezh2 could modulate obesity.
Therefore, in this study, we evaluated the effects of GSK126, a potent, highly selective small-molecule inhibitor of Ezh2 methyl- transferase activity, which decreases global H3K27me3 levels [16], in obese mice fed a high-fat diet (HFD). Our results provided important insights into the mechanisms of beige adipocytes dif- ferentiation in mice and revealed the potential therapeutic effects of GSK126 in diet-induced obesity.
⦁ Materials and methods
⦁ Animal care and treatment
¼
C57BL/6J male mice were housed in a pathogen-free facility at the The Air Force Medical University with a 12-h light/dark cycle and free access to standard irradiated rodent chow (5% energy from fat; XieTong Organism, China) until reaching 6 weeks of age. The diet was then changed to an HFD (60% energy from fat; D12492i; Research Diets, USA). After 18 weeks, mice were randomized into two groups (n 9 per group), matched for body weights (Fig. 1A). Mice were treated with the same volume of vehicle (20% Captisol; HY-17031; MedChemExpress, USA; Control group) or GSK126 (50 mg/kg; S7061; Selleck Chemicals, USA; GSK126 group) intra- peritoneally once a day for 10 days. During the treatment, food intake was measured every day, and body weights were measured every other day. Fecal lipids were collected and tested as previously described [17]. After 10 days of treatment, for fasting blood glucose and glucose tolerance tests, mice were fasted for 16 h, and blood from tail vein was tested before and at 30, 60, 90, and 120 min after intraperitoneal injection of glucose (1.0 g/kg). For cold challenge experiments, rectal temperatures were measured before and every
hour after housing in a 4 ◦C environment with an electronic ther-
mometer for 5 h. During the cold challenge, mice had free access to food and water. After anesthetizing animals, blood from the heart was collected to prepare plasma for enzyme-linked immunosor- bent assays (ELISAs), and tissues were collected for morphology and molecular biology experiments. All experiments were approved by the Air Force Medical University Animal Ethics Com- mittee, China.
⦁ Histological analysis
Epididymal, mesenteric, subcutaneous white adipose tissues and interscapular brown adipose tissues were fixed, dehydrated, embedded in paraffin, sliced (3-mm-thick sections), and stained with hematoxylin and eosin (HE). Images were taken at 200 × or
400 × magnification.
⦁ Immunohistochemistry
Sections of WAT and BAT were deparaffinized, and antigen
retrieval was performed with a pressure cooker in citric acid- sodium citrate buffer for 2 min. Endogenous peroxidase activity was blocked with 3% H2O2 for 15 min. Antigen blocking was per- formed with 5% goat serum. Anti-Ucp1 antibodies (1:300; ab10983;
Abcam, USA) were applied overnight at 4 ◦C, and sections were
then incubated with biotinylated secondary antibodies (SP9001; ZSGB-BIO, China). Histochemical reactions were performed using diaminobenzidine.
⦁ Western blotting and ELISAs
×
Total proteins were extracted using RIPA buffer containing a protease inhibitor cocktail according to the manufacturer’s in- structions, and proteins were then separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis on 8% or 15% gels and transferred to polyvinylidene difluoride membranes. Membranes were then blocked with 5% nonfat dry milk in 1 phosphate- buffered saline with Tween20. The following primary antibodies were used: anti-H3K27me3 (1:1000; ab192985; Abcam), anti-Ucp1 (1:1000; ab10983; Abcam), and anti-b-tubulin (1:1000; KM9003T; SUNGENE BIOTECH, China). Horseradish peroxidase-conjugated secondary antibodies (1:5000; ZDR-5306, ZDR-5307; ZSGB-BIO) were used for detection with chemiluminescence reagents (WBKLS0100; Millipore, USA).
ELISAs was carried out strictly according to the manufacturer’s instructions (Mouse Total Cholesterol ELISA Kit: ml037202; Mouse TG ELISA Kit: ml0377871; Mlbio, China).
⦁ Real-time reverse transcription quantitative polymerase chain reaction (RT-qPCR)
Total RNA was isolated from tissues using RNAiso Plus (9108; Takara, Japan). cDNA synthesis was performed with PrimeScript RT Master Mix (RR036A; Takara). Real-time qPCR was performed using TB Green Premix Ex Taq II (RR820A; Takara) on a CFX96 Real-Time PCR System (C1000 Touch Thermal Cycler; Bio-Rad, USA). Relative
gene expression was calculated using the 2-DDCt method and was
normalized to the expression of glyceraldehyde 3-phosphate de- hydrogenase (GAPDH). The PCR program was as follows: initial denaturation at 95 ◦C for 5 s, followed by 45 cycles of denaturation
at 95 ◦C for 5 s and annealing at 60 ◦C for 30 s. Primers were designed and synthesized by Takara Company (Table 1).
⦁ Statistical analysis
Data are presented as means ± standard deviations (SDs). Values were analyzed by two-tailed independent-sample Student’s t tests or paired t tests using SPSS16.0 or GraphPad Prism 5.0. Differences with P values of less than 0.05 were considered statistically significant.
⦁ Results
⦁ Treatment with GSK126 alleviated the obese phenotype and improved glucose tolerance in mice
After 18 weeks of feeding the HFD, mice were randomized into two groups and treated with vehicle or GSK126 once a day for 10 days. Starting from the sixth day of treatment, mice in the GSK126 group showed significantly decreased body weights compared with those before treatment (Fig. 1D; p < 0.05). On day 10, mice in the GSK126 group showed lower body weights than those in the con- trol group (Fig. 1D; p < 0.05), without significant differences in food intake nor in fecal lipid excretion (Fig. 1B and C; p > 0.05), indicating that these mice showed similar energy absorption.
Fig. 1. Treatment with GSK126 alleviated the obese phenotype and improved glucose tolerance in mice. A. Body weights before treatment in two groups (Control group, white bars; GSK126 group, black bars; n ¼ 9). B. Food consumption per mouse per day during the treatment (n ¼ 9). C. Fecal lipids (mg/g feces) per mouse per day during the treatment (n ¼ 9).
D. Body weights curves during the treatment of obese mice treated with vehicle (Control group, black squares) or GSK126 (GSK126 group, orange triangles). Orange*: p < 0.05, body
weights compared with day 0; blue*: p < 0.05, body weights in the GSK126 group compared with that in the control group (n ¼ 9). E. Ratio of epididymal WAT weights to body weights (n ¼ 9). F. Fasting blood glucose (n ¼ 3). G. Intraperitoneal glucose tolerance test and area under the blood glucose curves (AUC) (n ¼ 3). H. Relative mRNA expression levels of Slc2a4 in the liver, gastrocnemius (Gas.), epididymal WAT (Epi.), mesenteric WAT (Mes.), and subcutaneous WAT (Sub.) (n ¼ 3). I. HE staining of epididymal, mesenteric, and subcutaneous WATs in the two groups. The magnification was 200 × . Data are presented as means ± SDs. Statistical analysis: Student's t-test, *p < 0.05, **p < 0.01. (For inter- pretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
Table 1
Primer sequences used for real-time RT qPCR.
Genes Forward(5’-3’) Reverse(5’-3’)
Slc2a4 TCTTATTGCAGCGCCTGAGTC GCCAAGCACAGCTGAGAATACA
Pparg TGCAGCAGGTTGTCTTGGATG GGAGCCTAAGTTTGAGTTTGCTGTG
Adipoq TTCTGTCTGTACGATTGTCAGTGGA GGCATGACTGGGCAGGATTA
Fabp4 TGGGAACCTGGAAGCTTGTCTC GAATTCCACGCCCAGTTTGA
Acadl CCAAGAAGAAGTGATTCCTCACCAC ACCAATGCCGCCATGTTTCT
Cpt1b TGCCCATGTGCTCCTACCAG GCCCTCATAGAGCCAGACCTTG
Fasn ATTGGCTCCACCAAATCCAAC CCCATGCTCCAGGGATAACAG
Acaca AGTGATGGTGGCCTGCTCTTG AGCAGACGGTGAGCGCATTA
Ucp1 CACTCAGGATTGGCCTCTACGAC GCTCTGGGCTTGCATTCTGAC
Prdm16 CCTCGCCATGTGTCAGATCAA CTTTCACATGCACCAACAGTTCC
Elovl3 AGTGTTCCGTTGTTGTGTGG GGCACCATCTTTGGCATACT
Dio2 TGGCATGCCCTGTAGGTT TGAGAAGTCTGGTACATCAGCAA
Tfam TGAAGCTTGTAAATGAGGCTTGGA CGGATCGTTTCACACTTCGAC
COX1 CTTTTATCCTCCCAGGATTTGG GCTAAATACTTTGACACCGG
ND1 GGGATAACAGCGCAATCCTA ATCGTTGAACAAACGAACCA
CD137 CGTGCAGAACTCCTGTGATAAC GTCCACCTATGCTGGAGAAGG
Tbx1 GGCAGGCAGACGAATGTTC TTGTCATCTACGGGCACAAAG
Tmem26 ACCCTGTCATCCCACAGAG TGTTTGGTGGAGTCCTAAGGTC
GAPDH GCCTGGAGAAACCTGCCAAGTAT GATGCCTGCTTCACCACCTTC
After treatment, epididymal fat pads, which are primarily composed of white adipocytes and are easier to be collected owing
to their specific anatomical characteristics, were removed and weighted, and the ratio of epididymal fat pads weights to body
weights was calculated. The results showed that treatment with GSK126 decreased the amount of fat in the epididymal fat pads (Fig. 1E; p < 0.05). Moreover, fasting blood glucose tests (Fig. 1F) and intraperitoneal glucose tolerance tests (Fig. 1G) showed that mice treated with GSK126 had lower fasting blood glucose and improved glucose clearance (p < 0.05). To evaluate the effects of organs on glucose clearance, we analyzed the expression of solute carrier family 2 (facilitated glucose transporter), member 4 [Slc2a4], which is linked to glucose uptake in the liver, skeletal muscle (gastroc- nemius), and WAT from epididymal, mesenteric, and subcutaneous depots. The results showed that there were no significant differ- ences in gene expression in the skeletal muscle and liver, indicating that these organs did not contribute substantially to glucose up- take. However, we found increased expression of Slc2a4 in mesenteric WAT (p < 0.05), indicating that this tissue was likely to contribute to improved glucose clearance (Fig. 1H). Finally, we analyzed the histological characteristics of WAT. HE staining of epididymal, mesenteric, and subcutaneous WATs showed smaller cell and lipid sizes in the GSK126 group (Fig. 1I), supporting poor differentiation and/or fatty acid accumulation inside the lipids.
⦁ GSK126 decreased white adipogenesis and increased lipolysis
In three types of WATs and BAT, we detected decreased H3K27me3 after GSK126 treatment by western blot analysis, which is the catalytic product of Ezh2, indicating that the enzymatic ac- tivity of Ezh2 was inhibited successfully (Fig. 2A). In order to detect the influence of decreased H3K27me3 and to explain the alleviation of the obese phenotype, we analyzed the gene expression of markers of adipogenesis, adipose function, fatty acid b-oxidation, and fatty acid synthesis in these adipose tissues. Master regulators of adipogenesis (i.e., peroxisome proliferator-activated receptor [Ppar] g) and adipose function (i.e., adiponectin, C1Q and collagen domain containing [Adipoq], fatty acid binding protein 4 [Fabp4]) showed reduced expression; for example, Adipoq in the epididymal and mesenteric WATs (p < 0.05) and Pparg in the mesenteric WAT (p < 0.01) showed significantly reduced expression in the GSK126 group compared with that in the control group, suggesting poor differentiation of white adipocytes (Fig. 2BeD). We also found increased expression of carnitine palmitoyltransferase 1b (Cpt1b) in both epididymal and mesenteric WATs (p < 0.05) and of Acyl- Coenzyme A dehydrogenase, long chain (Acadl) in mesenteric WAT (p < 0.01) and subcutaneous WAT (p < 0.05), indicating increased fatty acid b-oxidation in these WATs in the GSK126 group. We also found downregulation of fatty acid synthase (Fasn) in subcutaneous WAT (p < 0.05), indicative of decreased lipid syn- thesis (Fig. 2EeG). At the same time, we detected less fatty acids in the livers of GSK126-treated mice, as demonstrated by HE and Oil Red O staining (Fig. 2H). TGs (p < 0.05) was also decreased in the plasma of the GSK126 group, as demonstrated by ELISAs (Fig. 2I). These data indicated that treatment with GSK126 increased lipol- ysis and fatty acids consumption, and decreased its accumulation in mice.
⦁ Treatment with GSK126 increased energy dissipation by thermogenesis
Decreased body weight, increased lipolysis, and decreased fatty acids in circulation and the livers suggested increased fatty acid consumption as fuel in some organs of mice in the GSK126 group. During the experiment, we did not observe increased physical ac- tivity of mice in the GSK126 group, so we think there may be increased energy dissipation by thermogenesis. To investigate whether GSK126 affected thermogenic capacity in diet-induced obese mice, we performed cold exposure experiments. After
acute exposure to 4 ◦C for 5 h, GSK126-treated mice were able to better cope with the cold challenge and maintain core temperature (p < 0.05; Fig. 3A). During the experiment, we did not observe any shivers in mice. The organ that is primarily responsible for the regulation of body temperature via nonshivering thermogenesis is BAT. HE staining showed that GSK126 apparently reduced cell and lipid droplet sizes in BAT (Fig. 3B); however, immunohistochem- istry and western blot analysis for Ucp1 showed no differences between the two groups (Fig. 3B and C). Furthermore, gene expression analysis did not show significant differences in the mRNA levels of the key thermogenesis regulator Ucp1 and of the other genes typically expressed in BAT (PR domain containing 16 [Prdm16], elongation of very long chain fatty acids like 3 [Elovl3], Fig. 3D), but deiodinase, iodothyronine, type II [Dio2] mRNA increased in GSK126 group (p < 0.05; Fig. 3D). These results sug- gested that GSK126 increased thermogenesis in mice, but that BAT may play a limited role in this process. GSK126 and H3K27me3 altered the morphology of brown adipocytes, but slightly changed their thermogenic functions, suggesting that these factors may play complex roles in the differentiation of brown adipocytes in mice.
⦁ GSK126 induced the differentiation of beige adipocytes in mice
We detected alleviation of the obese phenotype as well as increased lipolysis and thermogenesis, which were not obviously related to BAT, in the GSK126 group. Interestingly, in both mesen- teric and subcutaneous WAT sections, we found that adipocytes contained multiple small lipid droplets (Fig. 1I). Taken together, these findings suggested that GSK126 may induce beige adipocytes and that these cells consumed fatty acids as fuel via thermogenesis in mice. Therefore, we performed immunohistochemical analysis of Ucp1 for these two types of WATs for confirmation of these find- ings. The results showed positive Ucp1 expression in these two WATs in the GSK126 group (Fig. 4A). Gene expression analysis showed that the browning gene Ucp1 was upregulated in both mesenteric and subcutaneous WATs (p < 0.05) and that Prdm16 and Dio2 were also upregulated in mesenteric WAT (Fig. 4B; p < 0.05). Mitochondrial respiration is central to adaptive thermogenesis, and enriched mitochondria are markers of beige adipocytes. Ucp1 is expressed in the inner mitochondrial membrane [18]; therefore, we predicted that the number of mitochondria would be increased, and we examined the expression levels of a marker of mitochon- drial biogenesis (transcription factor A, mitochondrial [Tfam]) and some special markers of the electron transport chain (cytochrome c oxidase subunit I [COX1] and NADH dehydrogenase, subunit 1 [ND1]). We found up regulation of ND1 in mesenteric WAT (p < 0.05; Fig. 4B and C). We then tested markers of beige adipocytes (CD137, T-box-1 [Tbx1], and transmembrane protein 26 [Tmem26]) [19], and we found upregulation of Tbx1 in mesenteric WAT (p < 0.05) and of Tmem26 in subcutaneous WAT (p < 0.05; Fig. 4B
and C).
In summary, our data suggested that multilocular brown-fat- like cells in WAT were newly differentiated beige adipocytes and may make great contributions to energy consumption and dissi- pation and cold tolerance in mice treated with GSK126.
⦁ Discussion
Human obesity is often related to consumption of a diet enriched in fats and carbohydrates. Therefore, in this study, we used a diet-induced obese mouse model, which mimics overweight humans, for analysis of the mechanisms and treatment strategies for obesity. We found that mice treated with GSK126 had less WAT mass and smaller lipid droplet sizes after treatment. Moreover, important markers of white adipocytes, such as Pparg and Adipoq,
Fig. 2. GSK126 decreased white adipogenesis and increased lipolysis. A. Western blot analysis of H3K27me3 and b-Tubulin in epididymal, mesenteric, and subcurteous WATs and in BAT in the two groups. C: Control group; G: GSK126 group (n ¼ 3). BeD. Gene expression of markers of adipogenesis and adipose function in epididymal, mesenteric, and sub- cutaneous WATs in the two groups (n ¼ 3). EeG. Gene expression of markers of fatty acid b-oxidation and fatty acid synthesis in epididymal, mesenteric, and subcutaneous WATs in the two groups (n ¼ 3). H. HE and Oil Red O staining of liver tissues from obese mice treated with vehicle or GSK126. The magnification was 200 × . I-J. Plasma triglycerides and total cholesterol levels in the two groups, as tested by ELISAs (n ¼ 3). Data are presented as means ± SDs. Statistical analysis: Student's t tests, *p < 0.05, **p < 0.01. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
were downregulated. These results may reflect poorly differenti- ated white adipocytes and were consistent with the results of a study in vitro by Wang and colleagues showing that Ezh2 and its catalytic activity were required for the differentiation of white adipocytes [13]. At the same time, increased expression of fatty acid b-oxidation-related genes (i.e., Acadl and Cpt1b) and decreased fatty acids in the liver and in circulation were observed; these re- sults supported increased consumption of fatty acids as fuel. These effects may also be involved in determining the phenotype of less WAT mass and smaller lipid droplets size after treatment with
GSK126.
Because GSK126-treated mice were able to better cope with the cold challenge, we analyzed the classical interscapular BAT, which is the most important organ in the regulation of body temperature though nonshivering thermogenesis. In the study by Wang and colleagues, they found that Ezh2 was required for the differentia- tion of brown adipocytes in vitro [13]. Interestingly, in this study, we found smaller cell and lipid sizes of BAT in the GSK126 group; however, the expression of the thermogenesis-related gene and protein Ucp1 did not differ between groups. These results were
Fig. 3. Treatment with GSK126 increased energy dissipation by thermogenesis. A. Body temperatures of obese mice treated with vehicle or GSK126 exposed to a 4 ◦C environment for 5 h (n ¼ 3). B. HE staining and immunohistochemical analysis of Ucp1 in interscapular BAT. The magnification was 400 × . C. Western blot analysis of Ucp1 in interscapular BAT in the two groups (n ¼ 3). D. Gene expression of BAT markers in the two groups (n ¼ 3). Data are presented as means ± SDs. Statistical analysis: Student's t tests, *p < 0.05.
Fig. 4. GSK126 induced the differentiation of beige adipocytes in mice. A. Immunohistochemistry analysis of Ucp1 in the mesenteric and subcutaneous WAT in the two groups. The magnification was 200 × . B-C. Gene expression of markers of white fat browning, mitochondrion, and beige adipocyte in mesenteric and subcutaneous WAT in the two groups (n ¼ 3). Data are presented as means ± SDs. Statistical analysis: Student's t tests, *p < 0.05.
similar to the findings of Ferrari and colleagues, who used a chemical inhibitor of histone deacetylases (MS-275) to treat HFD- induced obese mice [15]. These results implied that GSK126, Ezh2, and H3K27me3 played complex roles in the differentiation of brown adipocytes in vivo. Further studies are still needed to explain this phenomenon.
Recent findings have suggested that adult humans have func- tional brown adipocytes, which are actually mainly beige adipo- cytes, and that these adipocytes can dissipate energy by thermogenesis [6]; these findings have supported that beige adi- pocytes may be a novel therapeutic target for obesity. In this study, in both mesenteric and subcutaneous fat from GSK126-treated mice showed the “browning” phenotype, as confirmed by morphology, immunohistochemistry, and gene expression
analyses. These findings may explain why the GSK126 group showed substantial decreases in body weights and blood glucose along with faster lipolysis and better cold tolerance.
We found obviously differentiated beige adipocytes in mesen- teric WAT in GSK126 group mice. It is well known that fat accu- mulation around the viscera is an independent risk factor for insulin resistance, type 2 diabetes, and atherosclerosis [3,20]; therefore, we propose that “browning” may be a practical way to change “bad fat” to “good fat”.
In summary, in this study, we found that GSK126 treatment alleviated the obese phenotype, glucose tolerance, and lipolysis in HFD-induced obese mice, suggesting that GSK126 may be a po- tential inducer of beige adipocytes to treat HFD-induced obesity. Moreover, we observed the different functions of Ezh2 and
H3K27me3 in the differentiation of three different types of adipo- cytes in mice for the first time; these factors promoted the differ- entiation of white adipocytes and inhibited the differentiation of beige adipocytes, and in brown adipocytes, these factors altered cell morphology but had limited influence on the expression of ther- mogenic genes. In the future, to confirm the role of Ezh2 and H3K27me3 in adipocytes differentiation in vivo, more research is still needed in genetically modified animal models. Further studies are also needed to elucidate the mechanisms in humans.
Disclosures
The authors report no conflicts of interest relevant to this article.
Funding
This work was supported by the National Nature Science Foundation of People’s Republic of China [31400722] and Education Department of Shaanxi Provincial government, China [17JK0654].
Acknowledgements
We would like to thank Professor Jing Ye’s laboratory group and Associate Professor Feng Zhang for helpful suggestions regarding the experiment design. We would also like to thank other members of the laboratory for valuable discussions regarding the manuscript. We thank Lixia Hao and Lijun Wang for administrative and tech- nical support.
Transparency document
Transparency document related to this article can be found online at https://doi.org/10.1016/j.bbrc.2018.04.073.
References
J.⦁ ⦁ Greener, F. Douglas, E.V. Teijlingen, More of the same? Con⦁ fl⦁ icting ⦁ per- ⦁ spectives of obesity causation and intervention amongst overweight ⦁ people, ⦁ health professionals and policy makers, Soc. Sci. Med. 70 (2010)⦁ ⦁ 1042e⦁ 1049.
⦁ P.G. Kopelman, P.G. Kopelman, Obesity as a medical problem, Nature ⦁ 404 ⦁ (2000)⦁ ⦁ 635e⦁ 643.
S.Y.⦁ ⦁ Lee,⦁ ⦁ H.J.⦁ ⦁ Chang,⦁ ⦁ J.⦁ ⦁ Sung,⦁ ⦁ et⦁ ⦁ al.,⦁ ⦁ The⦁ ⦁ impact⦁ ⦁ of⦁ ⦁ obesity⦁ ⦁ on⦁ ⦁ subclinical⦁ ⦁ coronary ⦁ atherosclerosis according to the risk of cardiovascular disease,⦁ ⦁ Obesity ⦁ 22 ⦁ (2014)⦁ ⦁ 1762e⦁ 1768.
I. Vucenik, J.P. Stains, Obesity and cancer risk: evidence, mechanisms, ⦁ and ⦁ recommendations,⦁ ⦁ Ann.⦁ ⦁ N.⦁ ⦁ Y.⦁ ⦁ Acad.⦁ ⦁ Sci.⦁ ⦁ 1271⦁ ⦁ (2012)⦁ ⦁ 37e⦁ 43.
E.⦁ ⦁ Mueller,⦁ ⦁ Understanding⦁ ⦁ the⦁ ⦁ variegation⦁ ⦁ of⦁ ⦁ fat:⦁ ⦁ novel⦁ ⦁ regulators⦁ ⦁ of⦁ ⦁ adipocyte ⦁ differentiation and fat tissue biology, Biochim. Biophys. Acta 1842 (2014) ⦁ 352e⦁ 357.
J.⦁ ⦁ Wu,⦁ ⦁ ⦁ P⦁ .⦁ ⦁ ⦁ Bost⦁ ro€⦁ m,⦁ ⦁ L.M.⦁ ⦁ ⦁ Sparks,⦁ ⦁ ⦁ et⦁ ⦁ ⦁ al.,⦁ ⦁ Beige⦁ ⦁ ⦁ adipocytes⦁ ⦁ ⦁ are⦁ ⦁ ⦁ a⦁ ⦁ ⦁ distinct⦁ ⦁ ⦁ type⦁ ⦁ ⦁ of ⦁ thermogenic⦁ ⦁ fat⦁ ⦁ cell⦁ ⦁ in⦁ ⦁ mouse⦁ ⦁ and⦁ ⦁ human,⦁ ⦁ Cell⦁ ⦁ 150⦁ ⦁ (2012)⦁ ⦁ 366e⦁ 376.
L.⦁ Sidossis, S. Kajimura, Brown and beige fat in humans: thermogenic adipo- ⦁ cytes that control energy and glucose homeostasis, ⦁ J. ⦁ Clin. Invest. 125 (2015) ⦁ 478e⦁ 486.
P.⦁ Lee, R. Bova, L. Scho⦁ fi⦁ eld, et al., Brown adipose tissue exhibits a glucose- ⦁ responsive thermogenic biorhythm in humans, Cell Metabol.⦁ ⦁ 23 (2016) ⦁ 602e⦁ 609.
M.⦁ Harms, P. Seale, Brown and beige fat: development, function and thera- ⦁ peutic potential, Nat. Med. 19 (2013)⦁ ⦁ 1252e⦁ 1263.
A.M.⦁ Cypess, S. Lehman, G. Williams, et al., Identi⦁ fi⦁ cation and importance of ⦁ brown adipose tissue in adult humans, New Engl, ⦁ J. ⦁ Med. 360 (2009) ⦁ 1509e⦁ 1517.
D.⦁ O⦁ ‘⦁ Carroll, S. Erhardt, M. Pagani, et al., The polycomb-group gene ezh2 ⦁ is ⦁ required⦁ ⦁ for⦁ ⦁ early⦁ ⦁ mouse⦁ ⦁ development,⦁ ⦁ Mol.⦁ ⦁ Cell⦁ ⦁ Biol.⦁ ⦁ 21⦁ ⦁ (2001)⦁ ⦁ 4330e⦁ 4336.
D.⦁ ⦁ Cakouros,⦁ ⦁ S.⦁ ⦁ Isenmann,⦁ ⦁ L.⦁ ⦁ Cooper,⦁ ⦁ et⦁ ⦁ al.,⦁ ⦁ Twist-1⦁ ⦁ induces⦁ ⦁ ezh2⦁ ⦁ recruitment ⦁ regulating histone methylation along the ink4a/arf locus in mesenchymal ⦁ stem⦁ cells, Mol. Cell Biol. 32 (2012)⦁ ⦁ 1433e⦁ 1441.
L.⦁ ⦁ Wang,⦁ ⦁ Q.⦁ ⦁ Jin,⦁ ⦁ J.E.⦁ ⦁ Lee,⦁ ⦁ et⦁ ⦁ al.,⦁ ⦁ Histone⦁ ⦁ h3k27⦁ ⦁ methyltransferase⦁ ⦁ ezh2⦁ ⦁ represses ⦁ wnt genes to facilitate adipogenesis, Proc. Natl. Acad. Sci. U.S.A. 107 (2010) ⦁ 7317e⦁ 7322.
A.Y. Sang, S.H. Um, J. Lee, et al., S6k1 phosphorylation of h2b mediates ezh2 ⦁ trimethylation of h3: a determinant of early adipogenesis, Mol. Cell. 62 (2016) ⦁ 443e⦁ 452.
A. Ferrari, E. Fiorino, R. Longo, et al., Attenuation of diet-induced obesity ⦁ and ⦁ induction of white fat browning with a chemical inhibitor of histone deace- ⦁ tylases,⦁ ⦁ Int.⦁ ⦁ J.⦁ ⦁ Obes.⦁ ⦁ 41⦁ ⦁ (2017)⦁ ⦁ 289e⦁ 298.
M.T.⦁ ⦁ Mccabe,⦁ ⦁ H.M.⦁ ⦁ Ott,⦁ ⦁ G.⦁ ⦁ Ganji,⦁ ⦁ et⦁ ⦁ al.,⦁ ⦁ Ezh2⦁ ⦁ inhibition⦁ ⦁ as⦁ ⦁ a⦁ ⦁ therapeutic⦁ ⦁ strategy ⦁ for⦁ ⦁ lymphoma⦁ ⦁ with⦁ ⦁ ezh2-activating⦁ ⦁ mutations,⦁ ⦁ Nature⦁ ⦁ 492⦁ ⦁ (2012)⦁ ⦁ 108e⦁ 112.
D. Kraus, Q. Yang, B.B. Kahn, Lipid extraction from mouse feces, Bio. Protoc 5 ⦁ (2015)⦁ ⦁ 1375e⦁ 1379.
V. Crowley, A.J. Vidal-Puig, Mitochondrial uncoupling proteins (ucps) ⦁ and ⦁ obesity,⦁ Nutr. Metabol. Cardiovasc. Dis. 11 (2001)⦁ ⦁ 70e⦁ 75.
R.A. Garcia, J.N. Roemmich, K.J. Claycombe, Evaluation of markers of ⦁ beige ⦁ adipocytes in white adipose tissue of the mouse, Nutr. Metab. 13 (2016) ⦁ 24e⦁ 37.
I.⦁ ⦁ Gabriely,⦁ ⦁ X.H.⦁ ⦁ Ma,⦁ ⦁ X.M.⦁ ⦁ Yang,⦁ ⦁ et⦁ ⦁ al.,⦁ ⦁ Removal⦁ ⦁ of⦁ ⦁ visceral⦁ ⦁ fat⦁ ⦁ prevents⦁ ⦁ insulin ⦁ resistance and glucose intolerance of aging: an adipokine-mediated process? ⦁ Diabetes 51 (2002)⦁ ⦁ 2951e⦁ 2958.